|  Help  |  About  |  Contact Us

Allele : Zfp326<em1(IMPC)J> zinc finger protein 326; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7612605 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp326
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TAGAATTTCCAATATTACAT and TATTAGAACACACTGATCTG. This resulted in a 460 bp deletion of Chr5:105,890,907-105,891,366(GRCm38/mm10) that removes exon ENSMUSE00001230407.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele