| Primary Identifier | MGI:7614851 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Alpk1 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Threonine codon 237 (ACA) in exon 9 was changed to methionine (ATG) (p.T237M) using an sgRNA (targeting ACAGGGCATTTCCACATCAC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with ROSAH (retinal dystrophy, optic nerve oedema, splenomegaly, anhidrosis and headache) syndrome. |
