| Primary Identifier | MGI:7614893 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mbtps2 |
| Strain of Origin | (C57BL/6J x CBA)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 2 was targeted by an sgRNA (targeting GTTGGGGACGGCGGAAAGCA) using CRISPR/Cas9 technology, resulting in the insertion of a single nucleotide (c.204_205insC), leading to a frameshift and premature stop codon (p.A69Rfs*40). |
