|  Help  |  About  |  Contact Us

Allele : Uprt<em1(IMPC)J> uracil phosphoribosyltransferase; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7618369 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Uprt
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CTGCAGTTAATACATGGTGG and GCTAGACTGGGGTTAGAGGA. This resulted in a 242 bp deletion of ChrX:104,498,165-104,498,406 (GRCm38/mm10) that removes exon ENSMUSE00000208388.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele