|  Help  |  About  |  Contact Us

Allele : Tfap2b<em1Sleep> transcription factor AP-2 beta; endonuclease-mediated mutation 1, Yu Hayashi

Primary Identifier  MGI:7627101 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Tfap2b
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  A G>A mutation (c.601+5G>A) was created in intron 3 using an sgRNA (equivalent to GTCAGTCATTAAAAAAGGTA) and an ssODN template with CRISPR/Cas9 technology. The mutation, which could affect the exon/intron 3 splice donor site, is the equivalent of the same human mutation associated with parasomnia (sleepwalking) in a Char syndrome patient. Transcription from this allele is normal.
  • mutations:
  • Single point mutation
  • synonyms:
  • Tfap2b<K144>,
  • Tfap2b<K144>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele