| Primary Identifier | MGI:7627101 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Tfap2b |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A G>A mutation (c.601+5G>A) was created in intron 3 using an sgRNA (equivalent to GTCAGTCATTAAAAAAGGTA) and an ssODN template with CRISPR/Cas9 technology. The mutation, which could affect the exon/intron 3 splice donor site, is the equivalent of the same human mutation associated with parasomnia (sleepwalking) in a Char syndrome patient. Transcription from this allele is normal. |
