| Primary Identifier | MGI:7627104 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Tfap2b |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A G>C mutation (c.822-1G>C) was created in intron 4 using an sgRNA (equivalent to TTTTCGATTTGGCTCTGCAG) and an ssODN template with CRISPR/Cas9 technology. The mutation, which changes exon 5 splice acceptor site CAG to CAC, is the equivalent of the same human mutation associated with short sleep in a Char syndrome patient. Transcription from this allele is very low and splicing is aberrant. |
