| Primary Identifier | MGI:7615290 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Pogz |
| Strain of Origin | C57BL/6NJcl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glutamine codon 1038 (CAG) in exon 19 was changed to arginine (CGG) (p.Q1038R) using an sgRNA (targeting GCAGCAGCTCCCTGTAAATG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.Q1042R mutation associated with autism spectrum disorder (ASD). |
