|  Help  |  About  |  Contact Us

Allele : Ccdc96<em1(IMPC)J> coiled-coil domain containing 96; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7643196 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ccdc96
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GAAAATGGACAGCCACTACG and AGGGGTGAAGCAAAAGATCA. This resulted in a 1,724 bp deletion of Chr5:36,484,659-36,486,382 (GRCm38/mm10) that removes exon ENSMUSE00000346252.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele