| Primary Identifier | MGI:7643616 | Allele Type | Endonuclease-mediated |
| Attribute String | Epitope tag | Gene | Nhlrc1 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | GCG linker sequence, followed by sequence for a double c-myc tag, was inserted immediately upstream of the stop codon using an sgRNA (targeting AAGTGATGGAGGGCAACGGA) and an ssODN template with CRISPR/Cas9 technology. |
