|  Help  |  About  |  Contact Us

Allele : Dph1<em2Swei> diphthamide biosynthesis 1; endonuclease-mediated mutation 2, Shuo Wei

Primary Identifier  MGI:7645690 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Dph1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Glutamic acid codon 237 (GAG) in exon 2 was changed to glutamine (CAG) (c.709G>C:p.E237Q) using an sgRNA (equivalent to TGGAGATGGCCGCTTTCATC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.E242Q mutation found in a patient with diphthamide deficiency syndrome 1 (developmental delay with short stature, dysmorphic facial features, and sparse hair 1, DEDSSH1).
  • mutations:
  • Single point mutation
  • synonyms:
  • Dph1<E237Q>,
  • Dph1<E237Q>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele