| Primary Identifier | MGI:7645690 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Dph1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glutamic acid codon 237 (GAG) in exon 2 was changed to glutamine (CAG) (c.709G>C:p.E237Q) using an sgRNA (equivalent to TGGAGATGGCCGCTTTCATC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.E242Q mutation found in a patient with diphthamide deficiency syndrome 1 (developmental delay with short stature, dysmorphic facial features, and sparse hair 1, DEDSSH1). |