|  Help  |  About  |  Contact Us

Allele : Msln<em2Strom> mesothelin; endonuclease-mediated mutation 2, Ingunn Stromnes

Primary Identifier  MGI:7645424 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Msln
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using CRISPR/Cas9 technology, SgRNAs recognizing exon 4 of Msln (GGCCAAGAAAGAGGCCUGUG; +25753054; ENSMUST00000238120) were targetted result in Msln indel causing disruption.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Msln<->,
  • Msln<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele