|  Help  |  About  |  Contact Us

Allele : Psmb1<em1(IMPC)J> proteasome (prosome, macropain) subunit, beta type 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7657517 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Psmb1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTATAGCTAGGAGCAGGATT and ACACCAAATTAATTTTAGGT. This resulted in a 487 bp deletion of Chr17:15,492,815-15,493,301(GRCm38/mm10) that removes exon ENSMUSE00000135936.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele