| Primary Identifier | MGI:7786709 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr577 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The Hoxb enhancer B4U retinoic acid response element (B4U-RARE) was targeted for binding site disruption using an sgRNA (equivalent to GAGGGGTGAACCGCAGGTCA) and an ssODN template with CRISPR/Cas9 technology, changing it from GGGTGAaccgcAGGTCA to GAATTCaccagTTCTCA. This allele was created in ES cells carrying the
function showMoreInlineList(listDiv) {
jQuery(listDiv + ' ul li').each(function(index) {
if (!jQuery(this).is(":visible")) {
jQuery(this).show();
}
});
jQuery(listDiv + ' ul li.show-more').hide();
}
function applyShowMoreInlineList(listDiv, listLength) {
jQuery(listDiv + ' ul li').each(function(index) {
listLength -= jQuery(this).text().length;
if (listLength <= 0) {
jQuery(this).hide();
}
});
if (listLength <= 0) {
jQuery('', {
'class': 'show-more',
'html': jQuery('', {
'href': '#',
'title': 'Show more items',
'text': 'Show more',
'click': function(e) {
showMoreInlineList(listDiv);
e.preventDefault();
}
})
}).appendTo(listDiv + ' ul');
}
}
|