|  Help  |  About  |  Contact Us

Allele : Rr583<em2Kejz> regulatory region 583; endonuclease-mediated mutation 2, Keji Zhao

Primary Identifier  MGI:7786758 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr583
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Ifng silencer CNS-28, located upstream, was targeted using sgRNAs (equivalent to ATTAAGACCTCGTTGAAGGC and GAGATCTTATCATGCCGTCT) with CRISPR/Cas9 technology, resulting in an ~150 bp deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • CNS-28<delta>,
  • CNS-28<delta>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele