| Primary Identifier | MGI:7787033 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr504 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The SRY-binding site TCTAAACAA (GRCm39:chr11:112108459-112108467) within the embryonic Sox9 testis enhancer was targeted using an sgRNA (equivalent to CTCAGCTGTTTGTTTAGAAGTGG) and an ssODN template with CRISPR/Cas9 technology, resulting in it being replaced with GGGGGGGGAA. This allele was created in zygotes carrying the Rr504em2Takas allele on the paternal chromosome and embryos carrying both alleles on the same chromosome were selected. |
