| Primary Identifier | MGI:7705118 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr499 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The Ptf1a 5' enhancer was targeted by three sgRNAs (equivalent to CACAAGTGGCGACATTCCCA, ATAACACATGTGCTGGGGCG and CCGCAGAGCACGCCAGTCCG) and two ssODN templates using CRISPR/Cas9 technology, resulting in mutations in the E-box of the near and in the TC-box of the far autoregulatory PTF1-binding motif (GRCm39:chr2:19435683-19435686) replaced with CCAT and chr2:19436904-19436909 replaced with GATATCTTATGA. |
