| Primary Identifier | MGI:7705093 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr500 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The Ptf1a 3' dorsal neural tube enhancer was targeted by an sgRNA (equivalent to GGGTAACCATTGGTTTGATT) using CRISPR/Cas9 technology, resulting in a 32 bp deletion (GRCm39:chr2:19463819-19463850) overlapping the paired homeodomain (Pd-HD)-binding motif. This allele was created in conjunction with the Rr499em1Jejo allele. |