| Primary Identifier | MGI:7715223 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Modified regulatory region | Gene | Rr29 |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A G>A mutation (GRCm39:chr5:29,520,267) was created in Shh enhancer ZRS or MFCS1 (mammals-fish conserved sequence 1), located in intron 5 of Lmbr1, using an sgRNA (targeting GAATGCATGCAGGAACTCAGGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the 396C>T mutation in the human ZRS enhancer associated with polydactyly (coordinate in reference to 789 bp enhancer chr7:156,791,087â156,791,875; hg38). |
