| Primary Identifier | MGI:7720869 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr556 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Brachyury enhancer I was targeted using crRNAs/tracrRNAs (targeting AAAGGTCACCGCTATGGTGT and ACACTACAAACAGCGCTTAC) with CRISPR/Cas9 technology, resulting in a 1106 bp deletion (GRCm39:chr17:8666208-8667313). This allele was generated using zygotes containing the Rr343518em1Zkoz allele (where the C enhancer is deleted). |
