|  Help  |  About  |  Contact Us

Allele : LxMm-9c11<em1Ceki> LINE repeat x, subfamily 9, member c11; endonuclease-mediated mutation 1, Cecile King

Primary Identifier  MGI:7715162 Allele Type  Endonuclease-mediated
Gene  LxMm-9c11 Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  The ancient rodent LINE repeat, located between Slfn2 and Slfn1, was targeted using sgRNAs (equivalent to GTATGAATGCTTTACTTATGTGG and TGCCTAGCATCTCACCTCTATGG) with CRISPR/Cas9 technology, resulting in a 162 bp deletion (GRCm39:chr11:83006359-83006520).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Lx9c11<->,
  • Lx9c11<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele