| Primary Identifier | MGI:7780120 | Allele Type | Endonuclease-mediated |
| Gene | Alas2 | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A p.R452H (c.1355_1356delinsAT) mutation was introduced to exon 9 of the X-linked mouse Alas2 gene using homology directed repair (HDR) CRISPR/cas9 methodologies in C57BL/6NCrl blastocysts (sgRNA: GCATGTGTTTGACATTGCGC). PAM site was also changed during targeting with a linked c.522C>A (p.A174=). |
