|  Help  |  About  |  Contact Us

Allele : Rr588<em1Pike> regulatory region 588; endonuclease-mediated mutation 1, J Wesley Pike

Primary Identifier  MGI:7790880 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr588
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The Cyp24a1 renal super-enhancer containing vitamin-D-response-elements, located downstream, was targeted using sgRNAs (equivalent to TAGGGACAAGGCATCAGACGAGG and AGAGTCGAGCGGAAATGTGCAGG) with CRISPR/Cas9 technology, resulting in an ~17.5 kb deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • C24-DS1 KO,
  • C24-DS1 KO
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele