|  Help  |  About  |  Contact Us

Allele : Rr590<em2Pike> regulatory region 590; endonuclease-mediated mutation 2, J Wesley Pike

Primary Identifier  MGI:7790912 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr590
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The Cyp27b1 enhancer, located in an Eef1akmt3 (Mettl21b) intron, was targeted using sgRNAs (equivalent to GCATGCAATGGCCCTCCGTTTGG and CCCTTCCTTAGGGACTTCATGGG) with CRISPR/Cas9 technology, resulting in a 4569 bp deletion (GRCm39:chr10:126869870-126874438).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • M21-IKOP,
  • M21-IKOP
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele