|  Help  |  About  |  Contact Us

Allele : Del(13Rr492-Rr493)1Andg deletion, Chr 13, Guillaume Andrey 1
Primary Identifier  MGI:7666512 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region, Null/knockout Gene  Del(13Rr492-Rr493)1Andg
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  A section of genomic sequence, containing Pitx1 distal or pituitary gland enhancer PDE or Pit, Pitx1 enhancer RA4, the Macroh2a1 gene and Pitx1 pan-limb enhancer Pen, was deleted using sgRNAs (equivalent to GAAACCGGGAGACGGTGATC and CGTGCTATCGAGGGACTAAT ) with CRISPR/Cas9 technology.
  • mutations:
  • Intergenic deletion,
  • Intragenic deletion
  • synonyms:
  • Pitx1<del1>,
  • Pitx1<del1>
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Trail: Allele

Genome

0 Expresses

1 Mutation Involves

Trail: Allele

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele




MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom