|  Help  |  About  |  Contact Us

Allele : Del(13Rr494-Macroh2a1)2Andg deletion, Chr 13, Guillaume Andrey 2

Primary Identifier  MGI:7666514 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region, Null/knockout Gene  Del(13Rr494-Macroh2a1)2Andg
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  A section of genomic sequence, containing Pitx1 enhancer RA4 and most of the Macroh2a1 gene (with only a small part of the 5' end remaining), was deleted using sgRNAs (equivalent to TGCTAGGGACCTTACTGTAG and TAATGTATTAGAGGGGCGGC) with CRISPR/Cas9 technology.
  • mutations:
  • Intergenic deletion,
  • Intragenic deletion
  • synonyms:
  • Pitx1<del3>,
  • Pitx1<del3>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

1 Mutation Involves

Trail: Allele

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele