|  Help  |  About  |  Contact Us

Allele : Del(15Hoxc13-Hoxc4)3Andg deletion, Chr 15, Guillaume Andrey 3

Primary Identifier  MGI:7666520 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Del(15Hoxc13-Hoxc4)3Andg
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  The entire Hoxc cluster (Hoxc13, Hoxc12, Hoxc11, Hoxc10, Hoxc9, Hoxc8, Hoxc6, Hoxc5, Hoxc4) was deleted using sgRNAs (equivalent to GCTTAATTTGGCCGACGCAA and GGAGCGTTCTTAAACCCGAT) with CRISPR/Cas9 technology.
  • mutations:
  • Intragenic deletion,
  • Intergenic deletion
  • synonyms:
  • Hoxc<del>,
  • Hoxc<del>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

9 Mutation Involves

Trail: Allele

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele