|  Help  |  About  |  Contact Us

Allele : Pitx1<em1Andg> paired-like homeodomain transcription factor 1; endonuclease-mediated mutation 1, Guillaume Andrey

Primary Identifier  MGI:7666521 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pitx1
Transmission  Germline Strain of Origin  (129S6/SvEvTac x C57BL/6NCrl)F1
Is Recombinase  false Is Wild Type  false
molecularNote  A 16-kb H3K27me3-enriched region surrounding Pitx1 was deleted using sgRNAs (equivalent to TATCCAGGCAGTTTCACCCC and GCTGTAGTTAAAGGAAGCTGGG) with CRISPR/Cas9 technology.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Pitx<->,
  • Pitx<->,
  • Pitx<del>,
  • Pitx<del>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories

Trail: Allele