|  Help  |  About  |  Contact Us

Allele : Mrpl39<em1(IMPC)Ics> mitochondrial ribosomal protein L39; endonuclease-mediated mutation 1, Mouse Clinical Institute

Primary Identifier  MGI:7781820 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mrpl39
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  This allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 4 sgRNAs (equivalent to AGAGAAACAACGTGAATCCA, ATTGTGGGTACATCAATCCA,GGATAACCCTCTAAATCATC and GGGACTCCCGATGATTTAGA), resulting in a 737 bp deletion that includes exon 3 (ENSMUSE00000131646; GRCm39), leading to a frameshift and premature stop codon.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele