| Primary Identifier | MGI:7781823 | Allele Type | Endonuclease-mediated |
| Gene | Dyrk1a | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This allele was generated at the Institut Clinique de la Souris by co-electroporating Cas9 protein, a crRNA (CAAGCAGCCGCACTTCTATC)/tracrRNA and an ssODN template, which resulted in a p.A195T mutation in exon 6 (ENSMUSE00000131727; GRCm39). An XmnI diagnostic restriction site was introduced to facilitate genotyping. |