| Primary Identifier | MGI:7781827 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready | Gene | Mir678 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 2 sgRNAs (equivalent to ATGTCCGCATCTTGTGTCAG and CTACCCATGCAGAGTCCACT) and a 451 nt ssODN template, resulting in the introduction of loxP sites flanking the single exon (ENSMUSE00000660428; GRCm39) located in the Prmt2 3' UTR. |
