| Primary Identifier | MGI:7664584 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr487 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The enhancer, part of casein gene cluster super-enhancer Rr485, was deleted using sgRNAs (equivalent to TATACAGGAGGTTTGGAACTCCAGG and GGAATAATTTGGGGTCAGTGAGG) with CRISPR/Cas9 technology, resulting in a 723 bp deletion. |
