| Primary Identifier | MGI:7781507 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Txndc8 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GATTCAAGAGCTAATGTAAA and TCCCATTCATCATGGCATTC. This resulted in a 24,942 bp deletion of Chr4:57,984,170-58,009,111 (GRCm38/mm10) that removes exon ENSMUSE00000879731 through ENSMUSE00000452534. |
