|  Help  |  About  |  Contact Us

Allele : Mafb<em1Lutzy> MAF bZIP transcription factor B; endonuclease-mediated mutation 1, Cathy Lutz

Primary Identifier  MGI:7738389 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Mafb
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (TGGCCGCGGAGCTGAGCATG and GCGACGGCTGCGGGCGGCAA) were selected to excise and replace murine amino acids 5-202 in exon 1 of the MAF bZIP transcription factor B (Mafb) gene, on chromosome 2, with human amino acids 5-202 of MAFB (MAFB-201; ENST00000373313.3) exon 1 with the P71R (CCC to CGC) missense variant.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Mafb(P71R),
  • Mafb(P71R)
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele