| Primary Identifier | MGI:7738661 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pcdhb21 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CAAGAACCGAGGACCCTTCC and CTTTAGGAACCGAATATCAT. This resulted in a 2,225 bp deletion of Chr18:37,513,885-37,516,109 (GRCm38/mm10) that removes exon ENSMUSE00000343717. |
