| Primary Identifier | MGI:7738662 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ppp4r3c1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TGTACTAAGATTAGGTCTTT and CAAAATGACGTGGCCTAGCG. This resulted in a 2,415 bp deletion of ChrX:88,973,773-88,976,187 (GRCm38/mm10) that removes exon ENSMUSE00000550440. |