| Primary Identifier | MGI:7788892 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Del(5Rr112505-Rr112506)6Andg |
| Strain of Origin | (129S6/SvEvTac x C57BL/6NCrl)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Three Shh-enhancer-related CTCF-binding sites, located in a Lmbr1 intron, were targeted using sgRNAs (equivalent to AGGGCGTCAGGAAATTCCAC and TGAACTGCCAATCACCTGGG) with CRISPR/Cas9 technology, resulting in their deletion. This allele was created in ES cells carrying the Rr112510em2Andg, Rr112507em1Andg and Rr29em2Andg CTCF-bs deletion alleles and represents two possible deletions (GRCm39:chr5:29475428-29481255 and chr5:29475816-29481294). |
