| Primary Identifier | MGI:7782633 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr565 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The dioxin response element (DRE) in intron 3 of Pkm was targeted using an sgRNA (equivalent to AGGAAGTGGTTATGAAAGCAGGG) and an ssODN template with CRISPR/Cas9 technology, resulting in the deletion of the DRE core sequence GCGTG (GRCm39:chr9:59575386-59575390). |
