|  Help  |  About  |  Contact Us

Allele : Rr567<em1Ddu> regulatory region 567; endonuclease-mediated mutation 1, Denis Duboule

Primary Identifier  MGI:7785476 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr567
Is Recombinase  false Is Wild Type  false
molecularNote  Hoxd enhancer Rr567, located between Lnpk and Evx2, was targeted with sgRNAs (equivalent to ATCTATCACTATTTGCTCCC and ACGATACTTAAGACCTAGTC) using CRISPR/Cas9 technology, resulting in a 13,007 bp deletion (GRCm39:chr2:74444727-74457733).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Del(Prox),
  • Del(Prox)
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele