| Primary Identifier | MGI:7790506 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr585 |
| Strain of Origin | 129 x C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Satb1 putative enhancer was targeted using sgRNAs (equivalent to ACACACACTGTCTGTTGTGC and GCTGCCTGCTTTTACATATC) with CRISPR/Cas9 technology, resulting in an 1189 bp deletion (GRCm39:chr17:52187241-52188429). This allele was created in ES cells carrying the Satb1tm1Itan allele on the paternal chromosome and mice carrying the two alleles on the same chromosome were selected. |
