|  Help  |  About  |  Contact Us

Allele : Rr584<em2Itan> regulatory region 584; endonuclease-mediated mutation 2, Ichiro Taniuchi

Primary Identifier  MGI:7790509 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr584
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  The Satb1 IL4-responsive TH2-specific enhancer was targeted using sgRNAs (equivalent to GGATTGAAGTGTTCGCATGT and CAGTCAACATCAGAATTTCT) with CRISPR/Cas9 technology, resulting in an 828 bp deletion (GRCm39:chr17:52469270-52470097).
  • mutations:
  • Intergenic deletion,
  • Intragenic deletion
  • synonyms:
  • Satb1<deltaEth2>,
  • Satb1<deltaEth2>,
  • Satb1<deltaa>,
  • Satb1<deltaa>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele