|  Help  |  About  |  Contact Us

Allele : Rr429<em1Gan> regulatory region 429; endonuclease-mediated mutation 1, Lin Gan

Primary Identifier  MGI:7768148 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr429
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  The Fgf10 enhancer was targeted using sgRNAs (equivalent to CACTCCTACTACTACACAGT and CATCACGCTGTACAGATGAG) with CRISPR/Cas9 technology, resulting in a 966 bp deletion (GRCm39:chr13:118847702-118848667).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Fgf10 enhancer,
  • Fgf10 enhancer
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele