|  Help  |  About  |  Contact Us

Allele : Rr60913<em1Gan> regulatory region 60913; endonuclease-mediated mutation 1, Lin Gan

Primary Identifier  MGI:7768149 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr60913
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  The proximal Ntng2 enhancer was targeted using sgRNAs (equivalent to ACCTGCCTGTGTCCTTGTGT and GTCATCTTGAAGATACCAGA) with CRISPR/Cas9 technology, resulting in an 805 bp deletion (GRCm39:chr2:29162169-29162973).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Ntng2 enhancer -24,
  • Ntng2 enhancer -24
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele