| Help | About | Contact Us

Allele : Rr430<em1Gan> regulatory region 430; endonuclease-mediated mutation 1, Lin Gan

Primary Identifier	MGI:7768150	Allele Type	Endonuclease-mediated
Attribute String	Modified regulatory region	Gene	Rr430
Strain of Origin	C57BL/6J	Is Recombinase	false
Is Wild Type	false

molecularNote

The distal Ntng2 enhancer was targeted using sgRNAs (equivalent to AATGGGTAAAATGCCTACCT and CATCTGCTGAGCTACATCCT) with CRISPR/Cas9 technology, resulting in a 1564 bp deletion (GRCm39:chr2:29175131-29176694).

mutations:
Intergenic deletion

synonyms:
Ntng2 enhancer -35,
Ntng2 enhancer -35

earliestPublication:
Xu M, et al. (2024) ISL1 and POU4F1 Directly Interact to Regulate the Differentiation and Survival of Inner Ear Sensory Neurons. J Neurosci 44(8)

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

Other

0 Carried By

0 Driven By

2 Publication categories

Questions? Comments? Click here!

MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Your name:
Your email address:
Subject:
Message:	---- Current page: ---- /mousemine/report.do?id=76888357

MouseMine