|  Help  |  About  |  Contact Us

Allele : Gm39266<em1Kmm> predicted gene, 39266; endonuclease-mediated mutation 1, Kenneth M Murphy

Primary Identifier  MGI:7767851 Allele Type  Endonuclease-mediated
Attribute String  Modified isoform(s) Gene  Gm39266
Is Recombinase  false Is Wild Type  false
molecularNote  Exon 2, and the promoter upstream of it, was targeted using two sgRNAs (equivalent to CAGGCACAGTCTGGGTACAC and GGTAAGAAATCCTACCTCTG) with CRISPR/Cas9 technology, resulting in a deletion.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • s-pro<->,
  • s-pro<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele