| Primary Identifier | MGI:7767853 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gm39266 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A triple poly(A) signal cassette (synthetic + SV40 + mouse Pgk1) was inserted into intron 2 between exon 2 and Irf8 enhancer Rr172 using an sgRNA (equivalent to GGTAAGAAATCCTACCTCTG) and an ssODN template with CRISPR/Cas9 technology. |
