|  Help  |  About  |  Contact Us

Allele : Rr427<em1Kmm> regulatory region 427; endonuclease-mediated mutation 1, Kenneth M Murphy

Primary Identifier  MGI:7767906 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr427
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The Cebpa enhancer was targeted using sgRNAs (equivalent to AGGGCAATTTCAGCCCCAAG and ACGTAGACCCTCTCCTGACA) with CRISPR/Cas9 technology, resulting in a 552 bp deletion (GRCm39:chr:34855789-34856340).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Cebpa +37<->,
  • Cebpa +37<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele