|  Help  |  About  |  Contact Us

Allele : Rr427<em2Rdw> regulatory region 427; endonuclease-mediated mutation 2, Ruud Delwel

Primary Identifier  MGI:7767993 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr427
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The Cebpa enhancer was targeted using sgRNAs (equivalent to TGAAGCCTACACTACTTTGT, AGAGGTAGGAACTCCATTCC, AGAGCCTCGCTCAAGCCCAT and TTGAGACATCTGGTAACCTT) with CRISPR/Cas9 technology, resulting in an ~1.05 kb deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • +42<M>kb<->,
  • +42<M>kb<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele