| Primary Identifier | MGI:7797731 | Allele Type | Endonuclease-mediated |
| Gene | Pole | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Using CRISPR technology, a sgRNA (AGGGAATTTGAGAGGCAGTT) was designed to target the Pole gene to introduce CTC to GTT mutations resulting in a leucine acid to valine change at amino acid 424 (L424V). |
