|  Help  |  About  |  Contact Us

Allele : Rr544<em2Qli> regulatory region 544; endonuclease-mediated mutation 2, Qian Li

Primary Identifier  MGI:7856730 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr544
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Taar enhancer TE1, located between Taar1 and Taar2, was targeted using sgRNAs (targeting TGGTTGTGAGTTGCTTGTGG, TCAGCCTGTTAATTACCTGA, AGAACTTTCAGAGAGTTCCC, GAACCCAGAACTGACTTTTG, TATTCTAGAAATACAGATGT and AGCATCCTGGAGGTGAAATG) with CRISPR/Cas9 technology, resulting in a 1205 bp deletion (GRCm39:chr10:23805948-23807152). This allele was created in zygotes carrying the Rr545em1Qli TE2 deletion allele. This leads to the reduction in expression of most Taar genes without affecting olfactory gene expression.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • TAAR enhancer 1 & 2 double knockout,
  • TAAR enhancer 1 & 2 double knockout
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele