|  Help  |  About  |  Contact Us

Allele : Slc34a1<em1(EGFP/cre)Jsprk> solute carrier family 34 (sodium phosphate), member 1; endonuclease-mediated mutation 1, Joo-Seop Park

Primary Identifier  MGI:7856708 Allele Type  Endonuclease-mediated
Attribute String  Recombinase, Reporter Gene  Slc34a1
Strain of Origin  STOCK Slc34a1<tm1(EGFP/cre/ERT2)Bhum>/J Is Recombinase  true
Is Wild Type  false
molecularNote  Using CRISPR technology zygote carrying Slc34a1tm1(EGFP/cre/ERT2)Bhum allele was targeted with sgRNA (GGCGATCTCGAGCCATCTGC) designed to target the cre(ERT2) sequence in the SLC34a1(GCE) mutation to introduce a stop codon after the coding sequence of cre, creating a constitutively active cre-expressing allele.
  • mutations:
  • Insertion
  • synonyms:
  • Slc34a1eGFPCre,
  • Slc34a1eGFPCre
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

1 Driven By

Trail: Allele

3 Publication categories

Trail: Allele